facsmax cell disassociation solution (Genlantis inc)
90
Structured Review
Genlantis inc
facsmax cell disassociation solution
Facsmax Cell Disassociation Solution, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/facsmax+cell+disassociation+solution/facsmax+cell+dissociation+solution/pmc05811212-253-17-21
Average 90 stars, based on 1 article reviews
Facsmax Cell Disassociation Solution, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/facsmax+cell+disassociation+solution/facsmax+cell+dissociation+solution/pmc05811212-253-17-21
Average 90 stars, based on 1 article reviews
facsmax cell disassociation solution - by Bioz Stars,
2026-10
90/100 stars
Images
1) Product Images from "Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair"
Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Journal: eLife
doi: 10.7554/eLife.30657
Figure Legend Snippet:
Techniques Used: Mutagenesis, Sequencing, Recombinant, Plasmid Preparation, Labeling, DNA Library Preparation, Microarray, Cell Culture, Software, Extraction, Gene Expression
Related Articles
Affinity Magnetic Separation:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair Article Snippet: Chemical compound, drug , Trizol , Invitrogen , TRIzol Reagent:15596026 , . .. Chemical compound, drug , other:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, |